Index
>> FEBR. 2020 TXT
That is the (adapted ) text of my first warning in February 2020 translated in english at: bit.ly/2Uk9BE4 + tiny.cc/REV1316. Bear in mind the DATE of that text; is february 2020 in the first days of the Lockdown.
CONTENTS:
1. SYNOPSIS
2. OVERPOPULATION
3. THE LIMITS OF GROWTH
4. GLOBALIZATION
5. PANDEMIC 1320
6. PANDEMIC 2020
7. COVID-19 VIRUS
8. CRISPR CAS13
9. EVENT-201
10. ID-2020
11. BLOCKCHAIN
12. CONCLUSIONS
13. WHAT'S NEXT
14. NOTES
Corona virus COVID-19. At the time I (began to) write, 26.02.2020, there are 80k cases in the world, 30k recoveries and 2760 deaths due to the COVID-19 corona-virus. The dynamic map of the spread is here, controlled by the same people who simulated the pandemic, 2 months BEFORE his outbreak. And here a 3D map with the spread through the "globalized" airplanes. WHO estimates that a vaccine will not be synthesized until one year. That is 2021.
But what is going on? The key is at the end of the story!
For the impatient ones, it's the story about how to get from a pandemic to Revelation 13:16 That is, to the implant. With clear scientific data. It's the only information you need in this life, so find the time, and read!
1. SYNOPSIS
The virus is from animals (aviary-corona + bats corona-spikes) modified with gene-technic (Crispr) to spread among humans. EVENT-201 simulated a corona-type pandemics in October 2019, 2 months before the outbreak in China. Participants; WHO, Gates Foundation, the boss of Chinese microbiology, also a former chief CIA. At the same time, Alliance ID-2020 wants to inject in people a blockchain microchip together with a vaccine.
Gates is here involved too, as well as Hyperledger blockchain. Some links here, here and here. Because paper-money can spread diseases, it will be replaced with an injected chip worldwide. Pure contactless. This will be "the deception" accordingly Rev. 13. Against microchip-injection are the Christians (2 billion) because of Rev. 13: 16, along with damnation in Rev. 14: 11. Maybe Muslims too, because any body-modification is "haram".
This virus conspiracy it's the way to fulfill the Bible Prophecy R. 13:16 - the key-event in Revelation. This part (the precise deception method) is absent from John's text. Antichrist was described as a kind of "pseudo-savior"; but saving us from...what?
The steps are:
1. Pandemic triggered by a laboratory-controlled virus. CCN suggests the origin in the laboratory; the virus attacks (like HIV or Ebola), the protein named Furin; might be modified, in order to be super-contagious. It's not a classical "bio-weapon" but made especially for the purpose. See: MIT / Harvard, COVID-19; CRISPR CAS-13, having already a pan-virus antidote: CARVER. Maybe a regular vaccine too, done in advance. ... A simulation, EVENT-201 was performed first, involving the Chief of Chinese Microbiology, Bill Gates Foundation, WHO, etc. Two months later, the pandemic was launched in China (after a joint military game).
2. The epidemic induces world chaos and thus imposes a state of emergency worldwide; lockdown. The situation was prepared by the early imposition of " globalization " and "free trade" - thus absolute economic interdependence between states. In the meantime, "mass" electronics were introduced. Every kid has a pocket computer, 10000x stronger than the one on the Apollo lunar module. See the spider symbol in 14.NOTES.
3. As a reaction, the introduction of a mandatory global vaccine. Alliance ID-2020, Gates Foundation, Rockefeller, etc. Bill Gates is funding the vaccine ... and "warned us " in 2018! The vaccine begins to be compulsory already (even if it doesn't exist on the market yet).
4. The microchip with the Blockchain (Hyperledger) will be injected together with the vaccine; according to the open intention of ID-2020 Alliance. Justification? This is how we get rid of contact with paper-cash, which can transmit diseases! Whoever refuses, is the "public enemy of world health" and as such, punished under martial law. Accordingly to the Rev 20:4.
5. Technically speaking, it is possible to inject the crypto-ID (that is, the blockchain account/ID) directly into the DNA, which is changed forever by CRISPR technology. - This is the "Mark of the Beast"; dextrogyre which means " right-handed relative to the axis / forehead "(Strong transl.), because the DNA is dextrogyre - This might be the correct translation of the koine-Greek text from John's Revelation 13:16.
6. Technically speaking, the ID can be injected into a seemingly neutral area of the person's DNA, called " junk-DNA " - about 90% of the DNA! But it's not garbage; it still has unexplored functions, as Cambridge or Concordia Univ reveals! Once modified, you become a zombie. ( see Rev. 14:11 ). You lose the "natural fractal antenna" at your frequency. Precise howto for code insertion in DNA - check the end of this text.
7. Reason for both RFID-chip + ACGT/DNA code? The code-ID inserted into DNA cannot be deleted by a magnetic pulse. As Rev. 16 describes the war of Armageddon, a magnetic ionospheric pulse (HEMP) can be triggered during the war. The chip explodes (Rev. 16: 2), but the DNA-Mark resist and the cloned ledgers too (blockchain translated in DNA storage). => Blockchain system restart.
8. A possible reason why all the marked are doomed (Rev. 14:11)? The natural DNA (via ancestors) acts on the quantic level obviously, forming a QUANTIC ENTANGLEMENT BLOCKCHAIN in timespace, that is physical, not artificial, from the beginning of the World. If you corrupt this entanglement blockchain, is undoable to "natural" (unlike the invented math-codes). Else God should modify the entire Universe-events in order to modify the universal quantum blockchain where the small DNA natural blockchain is part of... About the "pit" in the Bible, check-out what's going on at CERN (www=666 in Gematria. See: 14: NOTES, at the end)
9. During the outbreak of the pandemic +lockdown (arrest at home), the 5G towers are mounted - mandatory for RFID microchip-ID function. You just see that ongoing. It's an instant global "takeover" after 30 years of preparation: globalization, www, etc.
10. The outbreak of a pandemic is the only way imaginable, to introduce a worldwide implanted electronic ID. What other "imperative" event for WILLINGLY lockdown for billions? Or for WILLINGLY mass-vaccine? (Mat. 16:15) A vaccine containing RNA-ID + RFID?? Any attack on the conspiracy is dismantled as "Russian propaganda ..." (sic). That's why the largest media trusts participate in Event-201 and ID-2020. The biggest lie/manipulation (with a real triggered microbe) in the history - the "deception" in the Bible. All world-rulers are in (Rev. 17:17) via Masonry.
11. It's impossible to shut-down a disease via complete lockdown. It will break out again and again. The lockdown is only a worldwide military putsch of NWO. Like in Irobot "stay-home" scene. During lockdown (WW-home-jail) they prepare the tech 4 NWO As COVID-tests are made via PCR machines, all DNA of the world is scanned-registered - for the explained purpose (see above). The huge production of PCR machines now, helps soon for the purpose of marking ID-DNA! This is the transhumanist plot.
Update: This is huge: J.H. Center, the one which organized Event-201 and the dynamic map, comes now with a new kind of vaccine anti-COVID-19; this one injects strains of RNA in your body; the classic vaccines injected only proteins similar to the virus envelope.
The mark-chip is here, patented: WO2020060606
As we can see, this is the "end of the world" (as in Johns Revelation), which was not in 2012 (as they mistakenly translated from Maya) but begins in 2020. Correctly after teh required REd-Monn eclypse series.
AND NOW, THE (LOOONG) STORY:
2. OVERPOPULATION
Surely, people overpopulate the planet today. Humans (as an animal species) are a strange phenomenon. Except for some monkeys, no big mammal has a monthly cycle, but annually (our reproduction is governed by the Moon / 28 days, not by the Sun). Thus humans are "designed" to multiply quickly. Atypical fast for their size!
Today we are (per kilogram taken) comparable to insects, which are the most numerous animals on the land. If a human has an average of 75 kg, insects "per kg" per person have 143 kg . No large mammal is even close to human numbers, except those we grow as food. Some make fewer children, naturally, as a reaction to "crowds" ... (some only 1.5 / woman )
When overpopulation occurs, the Bible says: "it is the time of the harvest" ( R 14:16 )
3. GROWTH LIMITS
In 1972 a book called " The Limits of Growth " was published. The authors are related to the Club of Rome. It is about growth versus limited resources; we cannot inflate the earth with a pump. And the Club of Rome is convinced that "the message still holds today" . Especially today!
But if the population continues to grow, driven by animal instincts, someone must die. That's the nature of things. And being many, many must die. We must give sacrifice to the God of Death (or Shiva by Indians or the Occultists). That is, " Malthusianism ": the overpopulation is wiped-out by disease and war, "naturally".
A first measure was the prohibition of DDT; thus (through mosquitoes + malaria) about 20 million died in Africa between 2004 and 2020. But this is not enough. Not war, but diseases are the best way to reduce the population. They are non-conflicting, discreet. "God" is to blame ... And they are "ecological", right? "Eco! - Rest in Elisyum greenfields"
4. GLOBALIZATION
Globalization (invented by socialists, see "International") is probably the scariest thing implemented in the last years; we depend on foreign production, the brains are heated by the internet, the money is "sucked" to the center. It's a castle from playing cards, which can fall down at once - that is, the whole globe! That was the idea, after all! :)
In the Bible, globalization corresponds to the " Tower of Babel ". When you think you've got God on your feet the castle falls ... It's a symbol and nothing more, but it expresses EVERYTHING (no matter what you think about that book).
There have been some globalizations in history, though not written as such; the first was that of Al. Makedon who "opened the Pandora's box" towards "Silk Road". It ended badly with inflation and chaos.
Then, there is the "Gothic Renaissance" - between 1100 and 1320 Italians ate macaroni made in China (hence the custom in Italy). The Eurasian trade was intense, and the Europeans did nothing more than stumble on the roads, visit or conquer the "Holy Land". (Like today, with "traveling") It ended badly, in a pandemic> Black Death - in 80 years the population of Eurasia shrank to 50%.
5. PANDEMIC 1320
Let's see what happened back then, in the Middle-age. Were the diseases "natural", "from God" or are persons involved in the whole thing? Maybe a little of both! It is a fact that nature will once react furiously to the destruction of the ecological balance, by the overpopulation of any species. But rather than expecting something unknown and uncontrollable, you better provoke something controllable in advance!
In order to control the fateful event, you need two things: be able to manipulate a pathogen, and to have protection: medications, vaccines. Does that seem impossible at the time? You might be perplexed to hear that alchemists knew both the handling of pathogens (such as Yersinia pestis from animal corpses) and: vaccine (derived from acupuncture), antibiotics such as essential oils ( thieves blend ) + colloidal silver and even tetracycline beer (very effective against Yersinia bacteria). So VIPs were protected. And this is angular, in any "biological war". When you trigger, you must have an antidote, for yourself.
This was the case with Justinian's Plague, which came from the trade with Egypt - where cereals were produced, but where most ancient alchemists existed. This was exactly when Constantinople was preparing to conquer Rome / Papal Seat. In fact, the plague broke out exactly on those ships (541 AD). Coincidence, of course ...
The reason for the plague after the "Gothic Renaissance"? About 1312 AD Philip of France and Pope Clement (from Avignon) destroyed the Order of the Templars (read " The Damned Kings "). But because the Templars were the "de facto" bankers of Europe, the Silk Road (and its finances) fell into the hands of the Tartars, who had already conquered China (the place of production).
Both Chinese and European secret societies (Templars) would have been interested in destroying Tatar domination on this trade route. So under Tatar domination, China first had galloping inflation (paper money) and then plague (Yersinia Pestis). About 1320 it broke out, and then spread to Europe ... Survivors? 50%. "Silk Road" was closed for 500 years.
Why don't you know these? Because official history only cares about what "alpha male" beat another "alpha male" ... It's a history for "monkeys". Nothing is hidden, but it seems "unimportant" to the chairmen. Although, this is actually the real history.
6. PANDEMIC 2020
Today's conditions resemble perfectly with those from 1320, maintaining proportions. Globalization, a financial center, all the production of consumer goods in China, etc. In the role of Gingis-Han, is Putin (boogeyman). Of course, intense travel hysterized by ubiquitous advertising: "discover new cultures" ... Cultures where some people (because of overpopulation) eat insects and bats.
COVID-19 also broke out in China as did Yersinia-Pestis 700 years ago. Because between the 2 events are exactly 700 years ("7" is a number preferred by occultists)
There is only one question; is it possible for someone to be involved in "helping nature" today? A bacterium cannot be used, because we have antibiotics, and thus the outbreaks can be "controlled in advance". So the only usable ones are viruses. We don't have too many defenses against viruses - sometimes the preventive vaccine doesn't even work.
But let's dig deeper into the subject, with "the latest research." Because as I said to cause but also control an epidemic, you must have 2 elements: the pathogen and means of defense; medication for VIPs.
7. COVID-19 VIRUS
This virus is actually part of a fairly common family. Some respiratory diseases, colds, and bad pneumonia are caused by viruses from the "corona" family.
We can see details on the "corona" page of Wikipedia. (which in this case is quite accurate). These corona are "enveloped viruses", meaning the RNA core is coated in a shell, as is the core in the nut.
We also know from Wikipedia that against these kinds of viruses the vaccine does not work always, it's quite hard to make a vaccine. Also in an adjacent article, we see that bats are a "black sheep" as (possible) reservoir for this kind of viruses (as rats were for plague). Converse, if you want to genetically manipulate viruses, first you look for them in bats ...
Because there are not even vaccines, it seems that it cannot be used as an "extinction weapon" because VIPs are not protected! (I put this essential condition in advance, see above) The question is: do we really have no means of counteracting such viruses with all modern technology and genetic engineering? Hmmmm ...
8. CRISPR CAS13
Let's now get acquainted with a fantastic tool called CRISPR. Avoiding unintelligible technical details, it's like "scissors + sewing machine" for DNA. In other words, if you know what you're doing, you can modify the DNA as a tailor fixes or creates clothes. For example, you can cut the DNA from the yeast, and insert a "hem" with a gene that produces rare essential oils impossible to be made chemically. Or enzymes. Or peptides. Anything is possible ... You are like God (but only apparently ...).
You can inject a text from the Koran or Bible into the DNA ( translated into the AGCT DNA bases). You can also inject a mathematical ID in base64 that uses translated numbers and letters in AGCT. Carverr provides this technology. This detail is angular because through it you can modify the DNA with the "Mark of the Beast". That is, a cryptographic blockchain hash inserted into the DNA. And this concerns not only Christians; anyone with altered DNA becomes "Zombie".
CRISPR-kit is sold "freely" and this is awful; no state can control the "monsters" that come out of the hands of a bad or even worse, insane tailor. But that's the situation.In the first phase, this kit knew only how to manipulate DNA, which is specific to complex organisms and bacteria. But after 2016, it was supplemented with elements that can manipulate RNA (which is kind of "half a DNA"). Well, RNA is specific to viruses, including "corona"! RNA is their "DNA" coated in said "envelope".
In other words, you can manipulate something in those viruses. And with that, we have half the "proof". We know they CAN, and HOW they can be manipulated. But we do not know yet if there is a specific medication for these viruses, easily modified. Well, there is! Last year (2019), scientists used CISPR CAS13 to create a method ( CARVER ) that kills new viruses in infected cells! And with this, we have the second condition: to have some VIP medication.
All "conspiracy" elements are met. It's just that they haven't been implemented ...
And now the really crazy story begins.
9. EVENT 201
On Friday, October 18, 2019, some important VIPs met at the ultra-luxury Pierre Hotel in New York to run a global simulation - Event 201 (link to the official site). What did the guys simulate at that time, in that peaceful gathering?
A global pandemic, created by a coronavirus, transmitted from bats to pigs and humans ... (sound familiar?) The result of the simulation: 65 million deaths worldwide, and a 40% drop in the stock market. The epidemic is resolved after one year, a vaccine appears and then the virus becomes "harmless" like a childhood disease (measles). If you haven't caught it yet, I mention that October 18, 2019 is 2 months before the first case of corona found in China - December 2019. So it's properly done: first, a simulation, to know what result you get. That's professional!
Who participates? No governments, and WHO is missing ... A bizarre mix of consortia through representatives + several organizations, including private ones; for example Bill Gates Foundation ( that with vaccines ) ... but also the World Economic Forum . All data is public here .
Among the participants are representatives of some companies: Hasti Taghi ( NBC & WEF ), Latoya D. Abbott ( Marriot Int. ), Martin Knuchel ( Lufthansa ) But also highly capable scientists. Specifically, George F. Gao , Chairman of the Center for Disease Prevention and Control of China and President of the Microbiology Institute of China. He also researched at Harvard (those with CRISPR-CAS13, see above). And its field of research it's microbiology, enveloped viruses (inclusive corona). Everything starts to be transparent...
10. ID-2020
That COVID-19 was manipulated is clear to me. That some scientists have already made the medication for VIPs, it's clear too. But, sorry, why Bill Gates is involved in all this? That he wants to slap the stocks, has a logic. But even more interesting is the logic of combining a vaccine (of which Bill is very obsessed) with an electronic ID (identity card). A microchip injected together with the vaccine.
Of course, this is just a "conspiracy theory", because something like this simply cannot be. Seriously? Here's the ID-2020 Alliance, the official website. With vaccine + ID: Microsoft, Gavi (Vaccine Alliance) Rockefeller Foundation, the blockchain alliance Hyperledger (+ some media straw-people). Combine the compulsory vaccine with an injected microchip! ( already created by IBM) Explanation in English in this article. Or here. The name of the alliance shows that the schedule is fixed: 2020.
Now everything is clear: controlled pandemic> mandatory vaccine> Bill puts the microchip in the vaccine> so in "our ass". Given the "state of emergency," you cannot refuse the vaccine because you "endanger public health"! What does health have in common with the microchip? ... Well, it's obvious: avoiding real cash you avoid infections. It's logical! In fact, without a pandemic, it would be impossible to justify such a thing. Well manipulated, what can I say...
It is clear what's about: Revelation 13:16 "That no one should be able to buy or sell without having the Mark of the Beast" ... etc. That is: implant. Faithful people! God help! So, for those who oppose the injection, the boys have already arranged in FEMA camps... 30,000 guillotines. Ordered by the US government in advance - à la Robespierre. This is the first death, Rev. 20: 6.
11. BLOCKCHAIN
Total surveillance by technology is a mathematical masterpiece called Blockchain. It's not just pure electronic money, that was created long ago in 1985 by Chaum. But that version was rejected, because it was not controllable "from the center"! Because the electronic money stayed with you on your computer, just like cash in your pocket!
The new "virtual currency" is not cash, but an immutable and unbreakable database. (details in English on this blog ) It's not cash or coin, because it's an account, and you don't own anything except the ID. (and the ID can be injected into the DNA with CRISPR) It is "centralized" to the cloned banks called "miners " who spy each other electronically, to not falsify the data. The cloned ledger (banks) plays a key role here. The moneyless world dreamed of by the Bolsheviks. There are "unofficial" or some "official" versions authoritatively controlled. It is clear which variant will be implemented ...
"Blockchains" have appeared from nowhere, the creator is anonymous. Who knows what "alien" is Satoshi Nakamoto? And if he is an " alien " who knows what his intentions are? Or who knows what superior (perhaps quantum ) mathematics he used?
Anyway, the whole "conspiracy" jumped on this boat, to control every soul on Earth. To put them in "mathematical chains". Like Prometheus tied to the stone when the eagle ate his liver ... They like "chains", like for slaves...
12. CONCLUSIONS
We now know the following:
1. The Middle-age pandemics could be "helped" by alchemists with 2 conditions: to know how to handle the microbe (plague at that time, easy to extract from animal carcasses) and then to have a secret antidote for VIPs: tetracycline in beer, essential oils, silver, vaccine (documented in China in the year 1000)
2. Today we can modify the RNA of a virus using the CAS13 enzyme and the CRISPR kit. We can also generate enzymes that destroy the virus in the host cell, using the same CAS13- CARVER. So there might be an antidote for VIPs. Also with CAS13 (and by the same specialists from Harvard), the virus is being investigated. Also through CRISPR, a blockchain-ID (a hash) can be injected into the DNA, more precisely in the "non-coding" part called "junk". So you can inject "Beast's Sign".
3. Timing: In mid-2019, the virus antidote was discovered at Harward, with CAS13. On October 18, 2019, a pandemic with corona from bats was simulated. The simulation was attended by the head of Chinese microbiology who also worked with the Harward team and specializes in enveloped viruses. One central player was the Bill Gates Foundation, the one with compulsory vaccines. Then, the virus was launched in China.
4. On his foundation site, Gates says, "All lives have equal value. We are impatient optimists working to reduce inequity." We must admit that facing death, we are all equal. Bill knows what he's saying. And he has humor - even if gloomy ... (He wants to reduce inequity! What do you have against him?) ... See? This is the fate of American inventors. Edison started with the light bulb and ended up inventing the electric chair. This one produced an operating system ( copied from Gary Kildall) some windows ( copied from Apple) and ended up copying bat viruses ... to put microchips in the ass of the world (plagiarized after John 13:16 ). Bad plagiarism, because the barcode is 666.
5. The intended task is to enforce a mandatory vaccine, and with it an injected microchip, according to the ID-2020 Alliance. Via vaccine, directly the code - into DNA. ... So everything, absolutely everything will be "digitalized" via Blockchain / Hyperledger. With the dextrogyre ID inside DNA - ( R 13:16 ). No money will be touched further, so nobody gets infected. He saved us! He is the "savior" (savior = soter, christ in Greek) ... He is also the anti-savior, because he has triggered the whole story. In Greek ... you know. Antichrist.
That's the outcome. God help!
13. WHAT COMES
We should understand why would be necessary to inject both the microchip and DNA-ID. For banking some electronics are clearly required; you can't make transactions with the DNA-ID. At the same time, the microchip can be removed relatively easily (a scalpel + local anesthetic, by the dentist). ... So having inserted the code directly into DNA, any falsification becomes impossible.
At the same time, a microchip can be "burned" by a microwave pulse. But you can still be identified via the DNA-ID; again a PCR test (just like for COVID now). Here another chapter of Revelation comes into play - 16: 2. "The first angel went and poured his bowl on the earth. A horrible, painful sore appeared on the people who had the mark of the beast and worshipped the image. " (upd: here the GMO vax can act too as autoimmune disease..)
Given that Rev 16 describes the preparation and conduct of the final war (Armaggeddon) we must say that the ionospheric EM pulse is a standard weapon in the case of world war. It does not kill the opponent, but it destroys its electronics, which is essential in modern warfare.
Consequence? All the small electronics will be burned; the implant, the mobile, a.s.o. Everything that is not protected in the Faraday cage. All the money being 100% digital at that time, everyone will run out of money. The total collapse will follow. Whoever somehow survives the famine will be forced to resort back to material money (metal, paper).
But the cloned systems of banks with blockchain (miners) will withstand, in their bunkers; that's why they are designed "cloned". So you can still be identified via DNA-ID. The Beast doesn't vanish! It's just that you have no money because all the peripherals are burned. And because the system can be restored through the cloned network from bunkers, that's why God must come and control the Beast directly.
14. NOTES
The Revelation: Maybe you wonder how John from Patmos could know all these details 2000 years ago. It's simple; through time-travel. If we can do it in the near future, why not God itself! With the resurrection, it is harder for us. So the "bigot, ignorant" text is completely true, and even scientific.
Beast: Regarding the technology with INTERNET + CRISPR, think about this: A spider first builds a web (the internet). Then injects the trapped victims (internauts, meaning billions here) with a paralyzing peptide gastric juice (here CRISPR + blockchain-ID). The spider is the only being on Earth that digests prey outside his body ... and then "sucks it with a straw". Maybe it's an "alien-arachnid." Or maybe just a symbol, like Arachne. The one who competed and defied gods ...
About data centralization (including DNA cryptographic codes) it is good to know that the "web" - that is, the www protocol - was invented at CERN. There is also the TIER-zero server. - the other providers (of the highest rank) have only level TIER-one. Curiously, TIER means "BEAST" in German ... And www in Hebrew gematria = 666 (vav-vav-vav) see Amos 4: 2 - the letter vav resembles a hook. At CERN they are in preparation for a "pit" Overall, "coincidences". A 30 years salamy-slice constructed trap, for mankind.
Quantum blockchain: The universe (made by God) works analogically not digitally exclusive. So, between 1-&-2 there is an infinite of steps. The whole time-arrow consists of a web of analog entanglements. Web forming a huge fabric - pictured in Antiquity as the web of Athen.
Those entanglement blockchains (see QFS) are unforgeable and irreversible because you must reverse the time! But if you reverse-it with a time-machine (changing a tiny piece) anything will be changed! Because DNA is bound by entanglement, it is irreversible in his hidden quality. In other words, it has a digital level (ACGT) but also a quantic level spreading toward GENERATIONS. This is irreversible. If you corrupt this chain everything is undoable.
This analog feature spreads up to macro-objects such as gold or assets (various, any material object). Hence their "physical unicity".
With digital things (one step between 1-&-2), this cannot be made without some global surveillance. Either central or distributed crypto-hash. Because the finite steps can be cloned and multiplied.
Howto: How can be made the "vaccine" with Blockchain-ID? "The Mark of the Beast"
A hash is generated, for example in BITADRESS. I generated one:
Secret address: L3mdJxXpHytepfpTaVVhufiqZagapvZDUv13x3HYBCiv3qygnuK4 Public address: 1E1z4xmjzQjnsk3QTVtmiPUZcQZyHUvBBi
The secret address is translated into ACGT - that is, the DNA bases - into DNA-WRITER
ATCGTGACATACTGCAGTAGTGAGCGTGACTAGCTA GAGGCTGAGTAGACTGTAGTACGTGATGCTCTGTAT GCAACTGTCACTGAGGTAGCATACGATGTATCTGTG AGTGTGCGTGACCATTCACTGGTAGTGTATGACGTC CTCGATTCGAGA
This small sequence of genes is actually transposed by a machine like this: KILOBASER which practically "prints" the molecules. Microsoft (Bill Gates) has a large-series device, as well as software for CRISPR - (CRISPR-ML) Further, it can be multiplied with a cheap PCR device.
In order to read the gene sequence, you need a device like these: NANOPORETECH and possibly a cheap PCR device. Between steps 3 and 4, remains an essential step: injecting this small DNA sequence into the "noncoding-DNA".This can be done with CRISPR / SATI ( SATI # 2 ) via vaccine ( Vectorbuilder synthetic viruses ), in the immediate future. Combined with the injected microchip.
Monocellular organisms or plants have already been "DNA-edited". You can see a GIF extracted from an edited bacterium. SATI allows "in vivo" insertion into non-coding DNA in mammals.
Of curse there are many paths to make GMO and change DNA. Using CRISPR-CAS9 and guideRNA a genenhacker modified his own genes. Using more refined tools like SATI you act on junk-RNA straight-away. And the subject don't die...
.